half-life raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
This page was last updated on 2026-03-31 and is reviewed periodically as new material appears.
Semaglutide is a synthetic peptide analog of human glucagon-like peptide-1, a gut hormone released after meals. Its backbone retains the GLP-1 sequence but incorporates two substitutions that slow enzymatic breakdown by dipeptidyl peptidase-4. A short polyethylene glycol linker and a C18 fatty diacid are attached to the peptide chain, allowing the molecule to bind serum albumin and remain in circulation far longer than the native hormone. The result is a circulating half-life measured in days rather than the minutes typical of endogenous GLP-1.
Receptor activation occurs at GLP-1 receptors distributed across pancreatic islets, the hypothalamus, and the gastrointestinal tract. Binding triggers G protein signaling that raises cyclic AMP and enhances glucose-dependent insulin release. Because the effect depends on prevailing glucose levels, insulin secretion does not rise when blood sugar is already low. Signaling in the brain and gut also influences appetite and gastric emptying, which is why the compound appears in both metabolic and weight-related research literature.
Development began in the early 2010s with the goal of extending GLP-1 activity beyond the brief window achieved by native peptide infusion. The earliest approved formulation was a subcutaneous injection given once weekly. A later oral tablet pairs the peptide with an absorption enhancer, sodium N-(8-[2-hydroxybenzoyl] amino) caprylate, usually shortened to SNAC. That carrier lowers local pH and helps the peptide cross gastric tissue. Both routes deliver the same active molecule.
Receptor binding triggers G protein signaling that raises intracellular cyclic AMP in pancreatic beta cells. Insulin release follows in a glucose-dependent manner, so secretion increases when blood glucose is elevated and diminishes when it is not. The same signaling suppresses glucagon release from alpha cells and slows gastric emptying, which blunts the post-meal glucose rise. In the brain, receptor activation in regions such as the arcuate nucleus is associated with reduced appetite and lower energy intake. How much each of these effects contributes to overall weight change is not fully settled.
Two structural features account for the prolonged half-life of semaglutide. A modified amino acid at position 8 resists cleavage by dipeptidyl peptidase-4, the enzyme that rapidly degrades native GLP-1. A fatty diacid side chain binds serum albumin, which limits renal clearance and protects the peptide from enzymatic breakdown. These modifications yield a plasma half-life of approximately one week in humans, allowing once-weekly administration. The relationship between plasma concentration and clinical effect varies between individuals, and sources of that variability are still being characterized.
Semaglutide is a synthetic peptide analog of glucagon-like peptide-1 (GLP-1), a hormone released from intestinal L-cells after food intake. The compound belongs to the incretin mimetic class and acts at GLP-1 receptors distributed across pancreatic, gastrointestinal, cardiovascular, and central nervous system tissues. Compared with native GLP-1, the molecule carries structural changes that extend its activity from minutes to roughly one week. It is studied for glycemic control in type 2 diabetes and for weight management, and its effects on cardiovascular and other outcomes remain active research areas.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Synthetic peptide, GLP-1 receptor agonist | Not a small molecule |
| Backbone substitutions | Non-natural residue at position 8, arginine at position 34 | Slows enzymatic cleavage |
| Side chain | C18 fatty diacid with PEG linker | Enables albumin binding |
| Approximate molecular mass | 4114 Da | Varies slightly with salt form |
| Reported half-life | About one week | Longer than native GLP-1 by orders of magnitude |
=== Resistance === Development of bacterial resistance under therapy is a frequent occurrence and makes fosfomycin unsuitable for sustained therapy of severe infections. Mutations that inactivate the nonessential glycerophosphate transporter render bacteria resistant to fosfomycin. Still, fosfomycin can be used to treat MRSA bacteremia. Prescribing fosfomycin together with at least another active drug reduces the risk of developing bacterial resistance. Fosfomycin acts synergistically with many other antibiotics, including aminoglycosides, carbapenems, cephalosporins, daptomycin and oritavancin. Enzymes conferring resistance to fosfomycin have also been identified and are encoded both chromosomally and on plasmids. Three related fosfomycin resistance enzymes (named FosA, FosB, and FosX) are members of the glyoxalase superfamily. These enzymes function by nucleophilic attack on carbon 1 of fosfomycin, which opens the epoxide ring and renders the drug ineffective. The enzymes differ by the identity of the nucleophile used in the reaction: glutathione for FosA, bacillithiol for FosB, and water for FosX. In general, FosA and FosX enzymes are produced by Gram-negative bacteria, whereas FosB is produced by Gram-positive bacteria. FosC uses ATP and adds a phosphate group to fosfomycin, thus altering its properties and making the drug ineffective.
=== Awards === 2023 Pulitzer Prize for Fiction, won Note: Hernan Diaz's Trust also won the award. This is the first time two books shared the award in its history. 2023 Orwell Prize for Political Fiction, shortlist 2023 Women's Prize for Fiction, won Note: The first author to win the prize twice; previously won in 2010 for The Lacuna. 2022 James Tait Black Prize for Fiction, won
One of the most powerful tools in physical organic chemistry is NMR spectroscopy. An external magnetic field applied to a paramagnetic nucleus generates two discrete states, with positive and negative spin values diverging in energy; the difference in energy can then be probed by determining the frequency of light needed to excite a change in spin state for a given magnetic field. Nuclei that are not indistinguishable in a given molecule absorb at different frequencies, and the integrated peak area in an NMR spectrum is proportional to the number of nuclei responding to that frequency. It is possible to quantify the relative concentration of different organic molecules simply by integration peaks in the spectrum, and many kinetic experiments can be easily and quickly performed by following the progress of a reaction within one NMR sample. Proton NMR is often used by the synthetic organic chemist because protons associated with certain functional groups give characteristic absorption energies, but NMR spectroscopy can also be performed on isotopes of nitrogen, carbon, fluorine, phosphorus, boron, and a host of other elements. In addition to simple absorption experiments, it is also possible to determine the rate of fast atom exchange reactions through suppression exchange measurements, interatomic distances through multidimensional nuclear Overhauser effect experiments, and through-bond spin-spin coupling through homonuclear correlation spectroscopy.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
Sources: en.wikipedia.org
John Scott Award, created in 1816 as the John Scott Legacy Medal and Premium, is presented to people whose inventions are deemed to have improved the "comfort, welfare, and happiness of human kind" in a significant way. Since 1919 the Board of Directors of City Trusts of Philadelphia provide this award, recommended by an advisory committee.
Historians have generally defined the party as conservative and wanting to maintain white Rhodesian interests by staunchly opposing majority rule, which the RF argued would lead to a collapse in economic development, law and order, and the emergence of a communist regime in Rhodesia. The party also encouraged immigration of whites from other African former colonies to Rhodesia. The RF maintained an all-white membership and wanted to continue the provision of separate amenities for different races in education and public services; thusly, the party was often characterised as racist both within Rhodesia and abroad. Ian Smith and the RF claimed that they based their policies, ideas, and democratic principles on meritocratic ideals and "not on colour or nationalism", stating that these policies and what he called "separate economic advancement" would ultimately result in an "equal partnership between black and white" as an alternative to majority rule. The Rhodesian Front was more moderate than the National Party, and never de jure disenfranchised non-white voters in their entirety and did not introduce apartheid-style legislation governing interpersonal relationships: marriage and relationships between whites and non-whites were possible and legal, albeit uncommon.
Coral reefs are under stress around the world. In particular, coral mining, agricultural and urban runoff, pollution (organic and inorganic), overfishing, blast fishing, disease, and the digging of canals and access into islands and bays are localized threats to coral ecosystems. Broader threats are sea temperature rise, sea level rise and pH changes from ocean acidification, all associated with greenhouse gas emissions. In 1998, 16% of the world's reefs died as a result of increased water temperature. Approximately 10% of the world's coral reefs are dead. About 60% of the world's reefs are at risk due to human-related activities. The threat to reef health is particularly strong in Southeast Asia, where 80% of reefs are endangered. Over 50% of the world's coral reefs may be destroyed by 2030; as a result, most nations protect them through environmental laws. In the Caribbean and tropical Pacific, direct contact between ~40–70% of common seaweeds and coral causes bleaching and death to the coral via transfer of lipid-soluble metabolites. Seaweed and algae proliferate given adequate nutrients and limited grazing by herbivores such as parrotfish. Water temperature changes of more than 1–2 °C (1.8–3.6 °F) or salinity changes can kill some species of coral. Under such environmental stresses, corals expel their Symbiodinium; without them, coral tissues reveal the white of their skeletons, an event known as coral bleaching.
Lore Alford Rogers (7 February 1875 – 21 March 1975) was an American bacteriologist and dairy scientist. He is credited with discovering that butter made from pasteurized sweet cream remained fresher than that made from sour ripened cream, while suggesting that surplus milk could still be sold as concentrated sour milk products. He refined the steps for manufacture of high quality Swiss cheese and, new to the United States, production of Roquefort cheese. He was instrumental in finding ways to discourage fungal growth in sweetened condensed milk and preventing losses in evaporated milk from heat coagulation. Rogers' pioneering work on freeze drying bacterial cultures had immediate applications in World War I. As Chief of the Research Laboratories of the Bureau of Dairy Industry, USDA for nearly four decades, Rogers was praised for a leadership style that allowed the "creativity of others" to be "developed and expressed." In retirement he gave back to his own community by co-founding the Patten Lumbermen's Museum.
Acute cutaneous lupus erythematosus Atrophoderma of Pasini and Pierini (dyschromic and atrophic variation of scleroderma, morphea plana atrophica, sclérodermie atrophique d'emblée) Calcinosis–Raynaud phenomenon–esophageal dysmotility–sclerodactyly–telangiectasia syndrome (CREST syndrome) Chilblain lupus erythematosus (chilblain lupus erythematosus of Hutchinson) Childhood dermatomyositis Childhood discoid lupus erythematosus Childhood systemic lupus erythematosus Complement deficiency syndromes Dermatomyositis Ehlers–Danlos syndrome Eosinophilia–myalgia syndrome Frontal linear scleroderma (en coup de sabre, morphea en coup de sabre) Generalized discoid lupus erythematosus Generalized morphea Interstitial granulomatous dermatitis Juvenile rheumatoid arthritis (juvenile idiopathic arthritis, Still's disease) Keloid morphea Linear atrophoderma of Moulin (Moulin atrophoderma linearis) Linear scleroderma Localized discoid lupus erythematosus Localized morphea Lupus erythematosus panniculitis (lupus erythematosus profundus, lupus panniculitis, lupus profundus, subcutaneous lupus erythematosus) Lupus erythematosus–lichen planus overlap syndrome (lichen planus–lupus erythematosus overlap syndrome) Methotrexate-induced papular eruption Mixed connective tissue disease (Sharp's syndrome, undifferentiated connective tissue disease) Morphea profunda Morphea–lichen sclerosus et atrophicus overlap Mouth and genital ulcers with inflamed cartilage syndrome (MAGIC syndrome) Neonatal lupus erythematosus Nephrogenic systemic fibrosis (nephrogenic fibrosing dermopathy) Nicolau–Balus syndrome Nodulosis–arthropathy–osteolysis syndrome Normophosphatemic familial tumoral calcinosis Palisaded neutrophilic and granulomatous dermatitis Pansclerotic morphea Parry–Romberg syndrome (progressive hemifacial atrophy) Progressive systemic sclerosis Relapsing polychondritis (atrophic polychondritis, systemic chondromalacia) Rheumatoid arthritis Rheumatoid nodulosis (accelerated rheumatoid nodulosis) Rheumatoid vasculitis Rowell's syndrome Scleredema adultorum (Bushke disease, scleredema diabeticorum, scleredema adultorum of Buschke, scleredema of Buschke) Silicosis Sjögren's syndrome (Mikulicz disease, Sicca syndrome) Subacute cutaneous lupus erythematosus Systemic lupus erythematosus Toxic oil syndrome Tumid lupus erythematosus (lupus erythematosus tumidus) Tuzun syndrome Verrucous lupus erythematosus (hypertrophic lupus erythematosus) Winchester syndrome
Sources: en.wikipedia.org
Native GLP-1 is degraded within minutes by circulating enzymes. The synthetic version carries substitutions at positions that block enzymatic cleavage, plus a fatty acid side chain that promotes albumin binding. These two changes together extend circulation time from minutes to roughly a week.
Albumin binding keeps a large fraction of the compound in a slowly released reservoir within the bloodstream. Plasma levels decline gradually rather than falling sharply after each administration. That profile supports dosing intervals measured in days instead of hours.
The active peptide sequence is the same in both formats. The oral version adds an absorption enhancer that is not present in the injected solution. Differences in excipients and formulation affect uptake rather than the identity of the active molecule.
Native GLP-1 is degraded within minutes by dipeptidyl peptidase-4 and cleared quickly. Semaglutide carries a position 8 substitution that blocks that cleavage and a fatty diacid chain that binds albumin. Together these changes extend its circulating half-life to about one week.